ID: 1186200001_1186200014

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1186200001 1186200014
Species Human (GRCh38) Human (GRCh38)
Location X:7147745-7147767 X:7147783-7147805
Sequence CCCGGTGGACCCCAGGGACTGCT CCCACGCGCGGGCCGCCGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 186} {0: 1, 1: 0, 2: 1, 3: 9, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!