ID: 1186200002_1186200014

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1186200002 1186200014
Species Human (GRCh38) Human (GRCh38)
Location X:7147746-7147768 X:7147783-7147805
Sequence CCGGTGGACCCCAGGGACTGCTC CCCACGCGCGGGCCGCCGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 199} {0: 1, 1: 0, 2: 1, 3: 9, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!