ID: 1186227403_1186227405

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1186227403 1186227405
Species Human (GRCh38) Human (GRCh38)
Location X:7414592-7414614 X:7414629-7414651
Sequence CCAAGAATGTTATCAGAGAAATA ATGCTTGTATAAATGAAACATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 31, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!