ID: 1186241116_1186241120

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1186241116 1186241120
Species Human (GRCh38) Human (GRCh38)
Location X:7567495-7567517 X:7567517-7567539
Sequence CCCCGAGCGACAGAGAATTCTCC CTGCCTGTCAGCTTTCAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 85} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!