ID: 1186241117_1186241124

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1186241117 1186241124
Species Human (GRCh38) Human (GRCh38)
Location X:7567496-7567518 X:7567535-7567557
Sequence CCCGAGCGACAGAGAATTCTCCT ACTGGGGCATAGACTCTTCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!