ID: 1186250507_1186250510

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1186250507 1186250510
Species Human (GRCh38) Human (GRCh38)
Location X:7660743-7660765 X:7660762-7660784
Sequence CCAAGGATGCCATGTACAGCAAT CAATTGCATCAAATATACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!