ID: 1186264185_1186264191

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1186264185 1186264191
Species Human (GRCh38) Human (GRCh38)
Location X:7813925-7813947 X:7813950-7813972
Sequence CCTTTCTGAGGAGTTTTGGACTG GTTTTTAAGGGAATTTTGGTGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 21, 3: 265, 4: 938}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!