ID: 1186266898_1186266911

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1186266898 1186266911
Species Human (GRCh38) Human (GRCh38)
Location X:7842987-7843009 X:7843037-7843059
Sequence CCCCGCCCCCGACTTCATCCGCC AAGGCCTTCCTTCCCGCCCAGGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 1, 3: 8, 4: 151} {0: 3, 1: 3, 2: 2, 3: 15, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!