ID: 1186266901_1186266909

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1186266901 1186266909
Species Human (GRCh38) Human (GRCh38)
Location X:7842992-7843014 X:7843018-7843040
Sequence CCCCCGACTTCATCCGCCATGTC ATGGTGCTTTGTGACGTATAAGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 1, 4: 61} {0: 3, 1: 3, 2: 0, 3: 2, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!