ID: 1186266906_1186266917

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1186266906 1186266917
Species Human (GRCh38) Human (GRCh38)
Location X:7843005-7843027 X:7843051-7843073
Sequence CCGCCATGTCCTGATGGTGCTTT CGCCCAGGGCGACCATTGGCTGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 1, 3: 14, 4: 231} {0: 1, 1: 2, 2: 3, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!