ID: 1186266912_1186266923

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1186266912 1186266923
Species Human (GRCh38) Human (GRCh38)
Location X:7843041-7843063 X:7843082-7843104
Sequence CCTTCCTTCCCGCCCAGGGCGAC GTGTTGACCAATCACAGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 19, 4: 212} {0: 6, 1: 0, 2: 0, 3: 11, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!