ID: 1186298887_1186298897

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1186298887 1186298897
Species Human (GRCh38) Human (GRCh38)
Location X:8177601-8177623 X:8177649-8177671
Sequence CCGTGTGGCCTCTGAATCTATAA AACATTACAGGTTAGATCTATGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 7, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!