ID: 1186419908_1186419910

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1186419908 1186419910
Species Human (GRCh38) Human (GRCh38)
Location X:9417344-9417366 X:9417361-9417383
Sequence CCTTGTTCCATCTTTCTTCACCC TCACCCCCATCCTCCACCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!