ID: 1186426106_1186426118

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1186426106 1186426118
Species Human (GRCh38) Human (GRCh38)
Location X:9465255-9465277 X:9465276-9465298
Sequence CCAGCGCCCGCGCTCTCTCCGGG GGACTCGGCGGCGGCGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 210} {0: 1, 1: 0, 2: 6, 3: 128, 4: 1001}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!