ID: 1186459831_1186459837

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1186459831 1186459837
Species Human (GRCh38) Human (GRCh38)
Location X:9739527-9739549 X:9739543-9739565
Sequence CCACTTGAGACACCTTCCCGGAA CCCGGAAGCAGGGTTTTCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113} {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!