ID: 1186467742_1186467750

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1186467742 1186467750
Species Human (GRCh38) Human (GRCh38)
Location X:9797224-9797246 X:9797252-9797274
Sequence CCATGCCTGCCATTTTACTTTTC CTGGCTGCCTGGAATGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 74, 4: 774} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!