ID: 1186496555_1186496574

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1186496555 1186496574
Species Human (GRCh38) Human (GRCh38)
Location X:10015918-10015940 X:10015970-10015992
Sequence CCGGCGCCACCGCGGATGCGCTG CGCCGAGAGCCCCCGGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66} {0: 1, 1: 0, 2: 2, 3: 21, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!