ID: 1186509066_1186509076

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1186509066 1186509076
Species Human (GRCh38) Human (GRCh38)
Location X:10117105-10117127 X:10117147-10117169
Sequence CCATGCTGTCTCATTTCAGCCTG TGTCCTCGGGGAGCAGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 453} {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!