ID: 1186514543_1186514555

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1186514543 1186514555
Species Human (GRCh38) Human (GRCh38)
Location X:10156816-10156838 X:10156856-10156878
Sequence CCGGGTTTTCTCTGGACACGAAT CGAATGACACTGGCACGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 82} {0: 1, 1: 0, 2: 0, 3: 0, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!