ID: 1186526742_1186526752

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1186526742 1186526752
Species Human (GRCh38) Human (GRCh38)
Location X:10255710-10255732 X:10255752-10255774
Sequence CCACTAACAGTGGCAGCTTGCTC CACAAACCCAGGTGGTGGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!