ID: 1186556026_1186556032

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1186556026 1186556032
Species Human (GRCh38) Human (GRCh38)
Location X:10559717-10559739 X:10559766-10559788
Sequence CCTGCCACCATCAACAGAGAAAG CTAGACTATAAGCTCCATGAAGG
Strand - +
Off-target summary No data {0: 10, 1: 78, 2: 431, 3: 1441, 4: 3200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!