ID: 1186610148_1186610155

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1186610148 1186610155
Species Human (GRCh38) Human (GRCh38)
Location X:11130981-11131003 X:11131023-11131045
Sequence CCACAGACTGCATGAGCAGCTCA TCTCTTGGTGAGAGAAGAGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!