ID: 1186669990_1186669996

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1186669990 1186669996
Species Human (GRCh38) Human (GRCh38)
Location X:11758337-11758359 X:11758364-11758386
Sequence CCAAGGCGCGAGTGCTGTACGAT AGGTGCCGCCGCGGAGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 123} {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!