ID: 1186670806_1186670809

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1186670806 1186670809
Species Human (GRCh38) Human (GRCh38)
Location X:11765438-11765460 X:11765452-11765474
Sequence CCATGTGTGACATCCTCCATCTT CTCCATCTTCCCTAGGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 184} {0: 1, 1: 0, 2: 1, 3: 46, 4: 781}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!