ID: 1186738897_1186738900

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1186738897 1186738900
Species Human (GRCh38) Human (GRCh38)
Location X:12496417-12496439 X:12496452-12496474
Sequence CCTGGTAATCTGTATATTTAACA TGCTTCTTTTCAGCTCAATTTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 14, 3: 124, 4: 623} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!