ID: 1186747421_1186747424

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1186747421 1186747424
Species Human (GRCh38) Human (GRCh38)
Location X:12583872-12583894 X:12583886-12583908
Sequence CCTCAGAAAGCGGGCGTCCAGGC CGTCCAGGCTTGAGGGTGCGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!