ID: 1186750737_1186750751

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1186750737 1186750751
Species Human (GRCh38) Human (GRCh38)
Location X:12619387-12619409 X:12619432-12619454
Sequence CCCCCACTGGTATCCCCCATAGC ATGGACAAAAGTGGCTTTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 15, 3: 37, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!