ID: 1186786629_1186786635

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1186786629 1186786635
Species Human (GRCh38) Human (GRCh38)
Location X:12962123-12962145 X:12962158-12962180
Sequence CCAGTGGCTTCCTAACTCATGCA CCAAAGTTCTTAAAATGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 255} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!