ID: 1186789694_1186789706

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1186789694 1186789706
Species Human (GRCh38) Human (GRCh38)
Location X:12984905-12984927 X:12984954-12984976
Sequence CCCCAGCGCTACCACACTTCAGG CAAACCACAGGCTGTGTCGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84} {0: 1, 1: 0, 2: 1, 3: 5, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!