ID: 1186801048_1186801049

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1186801048 1186801049
Species Human (GRCh38) Human (GRCh38)
Location X:13092672-13092694 X:13092691-13092713
Sequence CCACAAAGTGCTGCGGTGAGAAG GAAGCCCTGCCCTCAAGTCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!