ID: 1186863320_1186863324

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1186863320 1186863324
Species Human (GRCh38) Human (GRCh38)
Location X:13694664-13694686 X:13694687-13694709
Sequence CCGTGATGCTTTGGGGCACCTCA GCATGCAGTTTGGGAACCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!