ID: 1186870665_1186870679

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1186870665 1186870679
Species Human (GRCh38) Human (GRCh38)
Location X:13768191-13768213 X:13768239-13768261
Sequence CCAGCAGGAGCAAGACCAGGAGT GGCAGGGCAATCTGTGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 269} {0: 1, 1: 0, 2: 1, 3: 25, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!