ID: 1186884774_1186884781

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1186884774 1186884781
Species Human (GRCh38) Human (GRCh38)
Location X:13902572-13902594 X:13902624-13902646
Sequence CCAGCACTCTTCTATTCTGCCAC GAGCCAGCTGAAAATCCCTAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!