ID: 1187016660_1187016671

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1187016660 1187016671
Species Human (GRCh38) Human (GRCh38)
Location X:15335526-15335548 X:15335564-15335586
Sequence CCGGACCTCCCGCGGCTGCAGCC TGTTCCGCAGCACCAATCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 331} {0: 1, 1: 0, 2: 0, 3: 0, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!