ID: 1187018801_1187018807

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1187018801 1187018807
Species Human (GRCh38) Human (GRCh38)
Location X:15358177-15358199 X:15358215-15358237
Sequence CCATTCTTCATCTATAACTGCAG ACTGGGGCTAGCAGGTGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 239} {0: 1, 1: 0, 2: 1, 3: 28, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!