ID: 1187058358_1187058363

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1187058358 1187058363
Species Human (GRCh38) Human (GRCh38)
Location X:15762293-15762315 X:15762334-15762356
Sequence CCGGCTTTCAGCAATTACCGAAG TGTCAGAGTAAACCAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!