ID: 1187147832_1187147841

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1187147832 1187147841
Species Human (GRCh38) Human (GRCh38)
Location X:16653953-16653975 X:16653997-16654019
Sequence CCTGCCTGCTGCCTCATGTAATA AGGAGACAAACCCAGCTTCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!