ID: 1187161008_1187161011

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1187161008 1187161011
Species Human (GRCh38) Human (GRCh38)
Location X:16765297-16765319 X:16765331-16765353
Sequence CCTTTTTTTCTGAATAAATAAAG TGGCAAGGTATAAGTTATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 108, 4: 980} {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!