ID: 1187165980_1187165985

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1187165980 1187165985
Species Human (GRCh38) Human (GRCh38)
Location X:16804267-16804289 X:16804308-16804330
Sequence CCTTTGAATGGCTGCATGGTTTT TTATTTAACCAGTTCCCTATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 218, 4: 3516} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!