ID: 1187181457_1187181470

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1187181457 1187181470
Species Human (GRCh38) Human (GRCh38)
Location X:16946977-16946999 X:16947007-16947029
Sequence CCGAGCTCTTCGCGCGCTGTGCC CGGGCGGGGGCCCCGGGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 73} {0: 1, 1: 0, 2: 2, 3: 31, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!