ID: 1187185939_1187185941

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1187185939 1187185941
Species Human (GRCh38) Human (GRCh38)
Location X:16985685-16985707 X:16985726-16985748
Sequence CCTGATGGGCAGACTTGCTTTCT GTAGATACCCAGATCAATCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!