ID: 1187216631_1187216641

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1187216631 1187216641
Species Human (GRCh38) Human (GRCh38)
Location X:17283230-17283252 X:17283283-17283305
Sequence CCTGCAGCAGGCCAAGTGCTTCA GGTTCCAGTGGAGGGGAAGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 31, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!