ID: 1187307869_1187307872

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1187307869 1187307872
Species Human (GRCh38) Human (GRCh38)
Location X:18113473-18113495 X:18113513-18113535
Sequence CCTTTGGAACCACAGTATTTAAA GTTTCAACTCTGTAAGTGTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!