ID: 1187308473_1187308479

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1187308473 1187308479
Species Human (GRCh38) Human (GRCh38)
Location X:18118675-18118697 X:18118699-18118721
Sequence CCACAGTAGCATTCTCGGTCCAT CAGGGCAAGCCAGCAGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!