ID: 1187313641_1187313644

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1187313641 1187313644
Species Human (GRCh38) Human (GRCh38)
Location X:18171057-18171079 X:18171088-18171110
Sequence CCATAGACGTTACTTTGGACCAG TTGTGAAGAGTTTCTGAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45} {0: 1, 1: 0, 2: 1, 3: 19, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!