ID: 1187318531_1187318537

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1187318531 1187318537
Species Human (GRCh38) Human (GRCh38)
Location X:18220405-18220427 X:18220420-18220442
Sequence CCCAAGTCACCCCAACCCTGAGC CCCTGAGCCACCAAGAGCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 470} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!