ID: 1187318531_1187318545

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1187318531 1187318545
Species Human (GRCh38) Human (GRCh38)
Location X:18220405-18220427 X:18220457-18220479
Sequence CCCAAGTCACCCCAACCCTGAGC TCAGGATCACCTCACGTCTCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!