ID: 1187394379_1187394392

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1187394379 1187394392
Species Human (GRCh38) Human (GRCh38)
Location X:18906983-18907005 X:18907031-18907053
Sequence CCGCAAACCTGAGGTCCCCAAGG TCTCCCGGGGCTCGGGCGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 244} {0: 1, 1: 0, 2: 0, 3: 14, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!