ID: 1187505630_1187505636

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1187505630 1187505636
Species Human (GRCh38) Human (GRCh38)
Location X:19876012-19876034 X:19876056-19876078
Sequence CCTTACTATATATACAACATGAA TTCAAAACCCAGATGGGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 311} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!