|
Left Crispr |
Right Crispr |
| Crispr ID |
1187564433 |
1187564440 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
X:20434454-20434476
|
X:20434493-20434515
|
| Sequence |
CCCAGGTGATGCTGATGCTGCTG |
GGGTCTAGATCTAGAATAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 143, 1: 518, 2: 1064, 3: 1639, 4: 2403} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|